haplogroup g origin haplogroup g origin

Yunusbayev B, Metspalu M, Jrve M et al. G-CTS2488 or G2a2b2 (also known as G-L141.1; previously G-141 and G2a3b) was identified only in mid-2009 at Family Tree DNA. Vernesi C, Caramelli D, Dupanloup I et al. We attempted to localize the potential geographic origin of . To obtain For the human mtDNA haplogroup, see. G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus, as well as, at lower levels, other parts of Europe and South West Asia, especially an area including Turkey, Iran and the Middle East where G2a2b2a may have originated. Luis JR, Rowold DJ, Regueiro M et al. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. In descending order, G-P303 is additionally a branch of G2 (P287), G2a (P15), G2a2, G2a2b, G2a2b2, and finally G2a2b2a. In Egypt, studies have provided information that pegs the G percentage there to be between 2% and 9%. It has been found in Mexican mestizos. Ancient DNA suggests the leading role played by men in the Neolithic dissemination. Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a). To accommodate for variability in sample sizes and hg G content, haplogroup diversity was calculated using the method of Nei37 only in the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. Gene pool structure of Eastern Ukrainians as inferred from the Y-chromosome haplogroups. Haplogroup G was the first branch of Haplogroup F outside of Africa. [24] Haplogroup G-M201 is believed to have been relatively absent during Neolithic India; the frequencies of the G2a-P15 subclade for example was negligible in indigenous Indian populations. Cavalli-Sforza L, Menozzi P, Piazza A : The History and Geography of Human Genes. We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. [38][self-published source?] G-P16 has a high frequency in South and NW Caucasus, with the highest frequency among North Ossetians63.6%. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The identification of a new SNP can necessitate renaming of one or more categories. PLoS Biol 2010; 8: e1000536. A majority of members of G-P303 belong to one of its subclades, rather than to G-P303*, The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. The L141 mutation is found on the Y chromosome at 2948607. (2004) suggested the mutation took place only 9,500 years ago. L223 is found on the Y chromosome at rs810801 and 6405148 with a mutation from C to G. L223 was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. On the other hand, G2a3-M485-associated lineages, or more precisely its G2a3b-P303-derived branch, represent the most common assemblage, whereas the paraphyletic G2a3-M485* lineages display overall low occurrence in the Near/Middle East, Europe and the Caucasus. However, no clinal patterns were detected in the spatial autocorrelation analysis of the five sub-haplogroup frequencies with distance, suggesting that the distributions are not clinal but rather indicative of isolation by distance and demographic complexities. M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A. Semino O, Magri C, Benuzzi G, Lin AA, Al-Zahery N, et al. In the Near/Middle East, the highest P303 frequency is detected among Palestinians (17.8%), whereas in Europe the frequency does not exceed 6%. The new phylogenetic and phylogeographic information provides additional insights into the demographic history and migratory events in Eurasia involving hg G. The present study comprises data from 98 populations totaling 17577 individuals, of which 1472 were members of hg G. The haplogroup frequency data are presented in Supplementary Table S1. G-M377, now also known as G2b1, has previously been designated G2b and G2c. The British samples have inconsistent double values for STR marker DYS19 in many cases. OS thanks the Italian Ministry of the University: Progetti Ricerca Interesse Nazionale 2009 and FIRB-Futuro in Ricerca 2008 and Fondazione Alma Mater Ticinensins. Haplogroup definition, a set of similar haplotypes inherited together, or a group who shares a set of similar haplotypes, used to understand genetic lineages. The SNP L177 (a.k.a. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. You belong to a subgroup of haplogroup G (G-M201), The Caucasus Mountaineers, and your oldest. Haplogroup G is observed in this survey as G1-M285 and G2a-P15. PubMed The hg G-U1 subclade is characterized by several sub-clusters of haplotypes, including a more diverse cluster mostly represented by Caucasus populations. Am J Hum Genet 2000; 67: 15261543. Two sources of the Russian patrilineal heritage in their Eurasian context. (b) Principal component analysis by hg G sub-clades: (A) M285, P20, P287, P15, L92 P16, M286, M485, P303, U1, L497, M527, M406, Page19, M287 and M377 sub-haplogroups with respect to total M201. [39], Haplogroup G-M377 has been found at a frequency of 60% out of a sample of five Pashtuns in the Wardak region of Afghanistan. Zalloua PA, Xue Y, Khalife J et al. We attempted to localize the potential geographic origin of haplogroup G-M201 by considering those locations containing both G1-M285- and G2-P287-related lineages as well as the co-occurrence of high sub-haplogroup diversity. Haplogroup G first locations (T. Kandell). "[3], Previously the National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic. Network of 248 samples P303 derived from Supplementary Table S3. Int J Legal Med 1997; 110: 141149. Notably no basal G-M201*, Page94*(xM285, P287) chromosomes were detected in our data set. The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. Dulik MC, Osipova LP, Schurr TG : Y-chromosome variation in Altaian Kazakhs reveals a common paternal gene pool for Kazakhs and the influence of Mongolian expansions. contracts here. King RJ, DiCristofaro J, Kouvatsi A et al. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. Ancient DNA from European early neolithic farmers reveals their near eastern affinities. Proc Natl Acad Sci USA 2011; 108: 97889791. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. The overall coalescent age estimate (Supplementary Table S4) for P303 is 12600 years ago. Am J Hum Genet 2008; 82: 873882. In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. Hg G also occurs at frequencies ranging from 5 to 15% in both the rest of Near/Middle East and southern European countries (especially Italy and Greece), with a decreasing frequency gradient towards the Balkans and northern Europe. No labs have yet assigned them shorthand names. These latter labs also made use of raw data results reported by individuals tested for about 2,000 SNPs at 23andMe to provide new L or S-designated SNP tests. Almost all L141 men belong to L141 subclades. The G-P303 phylogenetic network was constructed using 248 G2a3b-P303-derived 19-locus haplotypes from populations representing Europe, Middle/Near East, South/Central Asia and the Caucasus and belonging to five sub-clades P303*, U1, M527, M426 and L497. It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. A network of 61 G2c-M377 lineages from Europe, the Near/Middle East and Central and South Asia reveals founder lineages (one pronounced founder in Ashkenazi Jews and a far distant one among South Asian individuals) and diverged lineages (Supplementary Figure S1). Beginning in 2008, additional G SNPs were identified at Family Tree DNA (L designations) and Ethnoancestry (S designations). Specifically, we intersected these criteria by applying the following filters. ), International Society of Genetic Genealogy, List of genetic results derived from historical figures, Y-chromosome haplogroups in populations of the world, Y-DNA haplogroups in populations of Europe, Y-DNA haplogroups in populations of the Caucasus, Y-DNA haplogroups in populations of the Near East, Y-DNA haplogroups in populations of North Africa, "Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus", Atlas of the Human Journey: Haplogroup G (M201), "The Geographic Origins of Ethnic Groups in the Indian Subcontinent: Exploring Ancient Footprints with Y-DNA Haplogroups", "Late Pleistocene human genome suggests a local origin for the first farmers of central Anatolia", "Early farmers from across Europe directly descended from Neolithic Aegeans", "Ancient DNA suggests the leading role played by men in the Neolithic dissemination", "Ancient DNA from European Early Neolithic Farmers Reveals Their Near Eastern Affinities", "From surnames to the history of Y chromosomes: the Sardinian population as a paradigm", "Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau", "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe", "Y Chromosomal Evidence for a Limited Greek Contribution to the Pathan Population of Pakistan", "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists", "A prehistory of Indian Y chromosomes: Evaluating demic diffusion scenarios", "Dual Origins of the Japanese: Common Ground for Hunter-Gatherer and Farmer Y-Chromosomes", "Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup", "Isolates in a corridor of migrations: a high-resolution analysis of Y-chromosome variation in Jordan", "Chromosome Diversity Characterizes the Gulf of Oman", "The Druze: A Population Genetic Refugium of the Near East", "The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations", "Geographical Structure of the Y-Chromosomal Genetic Landscape of the Levant: A Coastal-Inland Contrast", "The place of the Basques in the European Y-chromosome diversity landscape", "A Back Migration from Asia to Sub-Saharan Africa Is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes", "Kinship and Y-Chromosome Analysis of 7th Century Human Remains: Novel DNA Extraction and Typing Procedure for Ancient Material", "The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula", http://ytree.ftdna.com/index.php?name=Draft&parent=20173662, "..Project Rosters - Haplogroup G Project", "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood", "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events", "The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations", "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree", http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=L240;class=Sequence;ref=ChrY;start=3191153;end=3191153;feature_id=40369, "Improved Resolution Haplogroup G Phylogeny in the Y Chromosome, Revealed by a Set of Newly Characterized SNPs", "Identification of the remains of King Richard III", https://haplogroup.info/all-ancient-dna-full.xlsx, "Results from the Hamman Family Y-Chromosome DNA Tests", "Haplogroup G2a (Y-chromosomal DNA) - Eupedia", Y-DNA Haplogroup G and its subclades from the current year ISOGG haplotree. Evaluation of Y-chromosomal STRs: a multicenter study. Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists. Chiaroni J, King RJ, Myres NM et al. Nei M : Molecular Evolutionary Genetics. They arewith accompanying Y-chromosome locationsU5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). Thus inferences regarding migratory histories must be viewed cautiously, as diversities may have changed over the time spans discussed. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. Although progress has been recently made in resolving the haplogroup G phylogeny, a comprehensive survey of the geographic distribution patterns of the significant sub-clades of this haplogroup has not been conducted yet. The P303 SNP defines the most frequent and widespread G sub-haplogroup. Summary. L1771.1/ L177_1, L1771.2/L177_2, L177.3/L177_3) was withdrawn as an identifier by ISOGG in 2013, after it was "found to be an unreliable palindromic snp". Nature 2010; 466: 238242. Ashkenazi Jewish G2a1a men with northeastern European ancestry form a distinct cluster based on STR marker values. The 12f2a mutation, which characterizes haplogroup J, was observed in 445 subjects. Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. Eur J Hum Genet 2010; 18: 348353. Principal component analysis based on G sub-haplogroup frequencies was performed using the freeware POPSTR program (http://harpending.humanevo.utah.edu/popstr/). It has an extremely low frequency in modern populations, except (i) Iran and its western neighbors, and (ii) a region straddling south Central Siberia (Russia) and northern Kazakhstan. Because M201 was identified first, it is the standard SNP test used when testing for G persons. Mitochondrial DNA variation of modern Tuscans supports the near eastern origin of Etruscans. Although not exceeding 3% frequency overall, haplogroup G1-M285 reflects a branching event that is phylogenetically equivalent to the more widespread companion G2-P287 branch in the sense that both branches coalesce directly to the root of G-M201. The phylogeny obtained for haplogroup Q-M378 comprising 5.2% of the Ashkenazi paternal variation 24, shows a similar pattern to that observed for haplogroup G-M377 (Supplemental Figure S5). P257 was first reported in 2008. L2b1a. Chromosome Y microsatellites: population genetic and evolutionary aspects. Amongst the Madjars, G1 was found at a rate of 87%. Eur J Hum Genet 2007; 15: 485493. suggested that: "We estimate that the geographic origin of haplogroup G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. Zhivotovsky LA, Underhill PA, Cinnioglu C et al. IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. Haplogroup S, as of 2017, is also known as K2b1a. G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. G1-M285, previously described in the Iranian population . The following SNPs are so far identified as M201 equivalents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. SR thanks the Estonian Science Foundation for grant 7445 and M Metspalu for grant 8973. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria, Germany, but G2a subclades were not tested.[34]. Specifications for most markers have been previously reported,1, 17, 28 ISOGG 2011 (http://www.isogg.org/tree/). Haplogroup G1 is a primary subclade of haplogroup G . The genetic heritage of the earliest settlers persists both in Indian tribal and caste populations. Its estimated Td of 120953000 years ago suggests considerable antiquity allowing time to accumulate STR diversity and also to disperse relatively widely. (Previously the name Haplogroup S was assigned to K2b1a4. Haplogroup G (M201) is a human Y-chromosome haplogroup. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. PAU thanks Professor Carlos D Bustamante. The L141 mutation involves an insertion.[35]. The next largest subclade of G-P303 is characterized by the presence of the U1 mutation. [7], (Subclades here conform to the Y-DNA SNP definitions used by ISOGG In 2012, several categories found only in one man in research studies were removed from the ISOGG tree causing some renaming. A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations. These patterns have been related to different migratory events and demographic processes.2, 10, 11, 14, 15, 16. The discovery of new SNPs can result in assignment of new names to haplogroup categories. It is notable that tzi the 5300-year-old Alpine mummy was derived for the L91 SNP and his autosomal affinity was nearest to modern Sardinians.28, The G2a2-M286 lineage is very rare, so far detected only in some individuals in Anatolia and the South Caucasus. Although the phylogenetic resolution within hg G has progressed,1, 17 a comprehensive survey of the geographic distribution patterns of significant hg G sub-clades has not been conducted. Another frequent sub-clade of the G2a3-M485 lineage is G2a3a-M406 (Figure 2e). Geographic spread patterns of the P303-derived groups defined by L497, U1 and P15(xP303)-derived P16 and M406 lineages, all of which achieve a peak frequency of at least 10%, are presented in Figures 2bf, respectively. Rosser ZH, Zerjal T, Hurles ME et al. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. Iceman tzi, known to have been a haplogr. Am J Hum Genet 2004; 74: 10231034. Haplogroup L2b1a is a branch on the maternal tree of human kind. (2000) suggested 17,000 years ago. Interestingly, the decrease of hg G frequency towards the eastern European populations inhabiting the area adjacent to NW Caucasus, such as southern Russians and Ukrainians,18, 40 is very rapid and the borderline very sharp, indicating that gene flow from the Caucasus in the northern direction has been negligible. See more. The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. Taken as a collective group, P303-derived chromosomes are the most widespread of all hg G lineages (Supplementary Table S1 and Figure 2b) and clearly display differential geographic partitioning between L497 (Figure 2c) and U1 (xM527) (Figure 2d). Pichler I, Fuchsberger C, Platzer C et al. However, interpretations based on simple haplogroup frequency clines do not recognize underlying patterns of genetic diversification. We genotyped binary markers following PCR amplification, by either Denaturing High Performance Liquid Chromatography, RFLP analysis, Taqman assay (Applied Biosystems, Foster City, CA, USA) or direct Sanger sequencing methodology. Distribution. The hg G2a3b1c-L497 sub-cluster, on the other hand, has so far been found essentially in European populations and therefore is probably autochthonous to Europe. SD was also calculated for the age estimates according to the following formula: 25/1000 (ASD0 variance)/0.00069. Here we address this issue with a phylogeographic overview of the distribution of informative G sub-clades from South/Mediterranean Europe, Near/Middle East, the Caucasus and Central/South Asia. Zhivotovsky LA, Underhill PA, Feldman MW : Difference between evolutionarily effective and germ line mutation rate due to stochastically varying haplogroup size. This group was created for the folks who's paternal Y-DNA reflects they belong to haplogroup G2a (G-P15). Men with the haplogroup G marker moved into Europe in Neolithic times. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaians. Balanovsky O, Dibirova K, Dybo A et al. This video explains the migration route of Y-chromosome haplogroup G and the countries where it can be found today. Am J Hum Genet 2012; 90: 573. MH and MHS are thankful to the National Institute for Genetic Engineering and Biotechnology, Tehran, Iran, and the National Research Institute for Science policy, Tehran, Iran, for providing the samples. The G-M286 subclade (M286+) is small compared with G-L91. [4], Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. In human genetics, Haplogroup G-P303 ( G2a2b2a, [2] formerly G2a3b1) is a Y-chromosome haplogroup. They are found only in tiny numbers elsewhere. The phylogenetic relationships of the various sub-haplogroups investigated are shown in Figure 1. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. New insights into the Tyrolean Icemans origin and phenotype as inferred by whole-genome sequencing. Men who belong to this group but are negative for all its subclades represent a small number today. However, its sub-clades have more localized distribution with the U1-defined branch largely restricted to Near/Middle Eastern and the Caucasus, whereas L497 lineages essentially occur in Europe where they likely originated. The coalescent times (Td) of various haplogroups were estimated using the ASDo methodology described by Zhivotovsky et al,32 modified according to Sengupta et al.13 We used the evolutionary effective mutation rate of 6.9 104 per 25 years, as pedigree rates are arguably only pertinent to shallow rooted familial pedigrees,33 as they do not consider the evolutionary consequences of population dynamics including the rapid extinction of newly appearing microsatellite alleles. (2004) Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the . The second component, influenced by the relatively high presence of M377, separates Ashkenazi Jews from other populations (Figure 3a). [21] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population. New York: Columbia University Press, 1987. The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective. The expansion time of G-M406 in Anatolia is 12800 years ago, which corresponds to climatic improvement at the beginning of the Holocene and the commencement of sedentary hunter-forager settlements at locations, such as Gobekli Tepi in Southeast Anatolia, thought to be critical for the domestication of crops (wheat and barley) that propelled the development of the Neolithic. This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. There were only a few G categories until 2008 when major revisions to categories were made.